NR AJDU
AU Palmer,M.S.; van Leeven,R.H.; Mahal,S.P.; Campbell,T.A.; Humphreys,C.B.; Collinge,J.
TI Sequence variation in intron of prion protein gene, crucial for complete diagnostic strategies
QU Human Mutation 1996; 7(3): 280-1
PT letter
VT
HUMAN MUTATION 7:280-281 (1996)
LETTER TO THE EDITOR
Sequence Variation in Intron of Prion Protein Gene, Crucial for Complete Diagnostic Strategies
Communicated by Peter Goodfellow
To the Editors:
We have isolated a 450bp PvuII fragment from the prion protein gene, which includes 95bp of intron sequence flanking the 5' end of exon 2. This fragment contains four differences from the flanking region previously published (Hsiao et al., 1989), including an A-G transition at position -21 (Fig.1). An oligonucleotide (PDG-106 5' CTATGCACTCATTCATTATGC 3') from the 5' end of this fragment was used to amplify the flanking intron and open reading frame from two related patients with a valine 117 mutation. These samples were selected because an apparent allele loss had previously been seen when they were amplified with an oligonucleotide (PDG-45 5'GACATTCTCCTCTTCATTTTG 3') based on the published sequence (and which overlapped position -21). The mutant valine 117 allele of both patients was associated with the sequence present in oligo-45 (an A at -21), whereas the normal wild-type allele contained the variant found in the new intron sequence at this point (a G at -21) (Fig.1). Both alleles from each sample were identical to the new intron sequence at all positions outside the oligo-45 region. It appeared therefore that the reason for the observed allele loss, found when amplifying samples with oligo-45, was a single A-G substitution near the 5' end of the oligo-nucleotide. We determined the frequency of this variation by amplifying DNA from 62 normal control samples and using allele-specific oligonucleotide hybridisation against the two variant sequences. All samples contained the G variant, whereas seven also contained the A variant. Therefore, the previously published intron sequence containing an A at - 21 is present in just 5.6% of alleles. All of the normal control samples with an A-variant had previously been shown to contain a noncoding polymorphism at codon 117 (alanine PvuII negative). The original patient from which the previously published intron sequence was derived also had a codon- 117 polymorphism. This intron variant is thus associated with both polymorphisms and mutations at codon 117 of the open reading frame, both of which also occur on alleles carrying the codon 129 valine polymorphism.
The significance of this intron variant lies in its proximity to the open reading frame containing exon 2. Because of this, oligonucleotides similar to PDG-45 containing the rarer A-variant have been used by numerous groups in amplifying this gene for diagnostic purposes and clinical decisions are being made based on the results (Gabizon et al., 1993, Hsiao et al., 1992, Kitamoto et al., 1993, Kretzschmar et al., 1992, Nicholl et al., 1995, Gwen et al., 1992, Ripoll et al., 1993). We recommend that amplifications that require inclusion of the intron exon boundary should use oligonucleotide PDG-106 or primers from the region of oligo PDG-106.
Mark S. Palmer*
Ronald H. van Leeven
Sukhvir P. Mahal
Tracy A. Campbell
Christine B. Humphreys
John Collinge
Prion Disease Group
Department of Biochemistry and Molecular Genetics
St. Mary's Hospital Medical School Imperial College of Science, Technology & Medicine
London W2 1PG, United Kingdom
Received August 29, 1995; accepted September 12, 1995.
*TO whom reprint requests/correspondence should he addressed.
LETTER TO THE EDITOR 281
-80 -60 -40
I I I
A TGATACCATTGCTATGCACTCATTCATTATGCAGGAAACATTTAGTAATTTCAACAT
106 ------------------> * *
B cattatgca-gaaacatttagtaatt-caacat
-20 -1
I I
A AAATATGGGACTCTGACGTTCTCCTCTTCATTTTGCAGIAGCAGTCATTATGGCG
* * I
B aaatatggaactctgacattctcctcttcattttgcagIagcagtcattatggcg
45 -------------------->
FIGURE 1. Comparison of sequence of prion protein gene intron-exon boundary obtained in this study (A) with that previously published (Hsiao et al., 1989) (B). The sequence to the left of the vertical bar is intron and to the right is exon 2. The open reading frame commences with the ATG shown in italics and the bold letters represent untranslated sequence.
The positions of oligonucleotides PDG-45 and PDG-106 are indicated. Differences between the two sequences are indicated by an asterisk; 94.4% of alleles were found to have the G variant at -21 of sequence A. The frequency of the three other variants was not determined; none were present in any of the alleles sequenced here.
---------
REFERENCES
Gabizon R, Rosenmann H, Meiner Z, Kahana I, Kahana E, Shugart Y, Ott J, Prusiner SB (1993) Mutation and polymorphism of the prion protein gene in Libyan Jews with Creutzfeldt-Jakob disease (CJD). Am J Hum Genet 53:828-835
Hsiao K, Baker HF, Crow TJ, Poulter M, Owen F, Terwilliger JD, Westaway D, Ott J, Prusiner SB (1989) Linkage of a prion protein missense variant to Gerstmann-Sträussler syndrome. Nature 338:342-345.
Hsiao K, Dlouhy SR, Fatlow MR, Cass C, Da Costa M, Conneally PM, Hodes ME, Chetti B, Prusiner SB (1992) Mutant prion proteins in Gerstmann-Sträussler-Scheinker disease with neurofibrillary tangles. Nature Genet 1:68-71.
Kitamoto T, Ohta M, Dohura K, Hitoshi S, Terao Y, Tateishi J (1993) Novel missense variants of prion protein in Creutzfeldt Jakob disease or Gerstmann-Sträussler syndrome. Biochem Biophys Res Comm 191:709-714.
Kretzschmar HA, Kufer P, Riethmüller G, DeArmond S, Prusiner SB, Schiffer D (1992) Prion protein mutation at codon-102 in an Italian family with Gerstmann-Sträussler-Scheinker syndrome. Neurology 42:809-810.
Nicholl D, Windl 0, de Silva R, Sawcer S, Dempster M, Ironside JW, Estibeiro JP, Yuill GM, Lathe R, Will RG (1995) Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene. J Neurol Neurosurg Psych 58:65-69.
Owen F, Poulter M, Collinge J, Leach M. Lofthouse R, Crow TJ, Harding AE (1992) A dementing illness associated with a novel insertion in the prion protein gene. Molec Brain Res 13:155-157.
Ripoll L, Laplanche J-L, Salzmann M, Jouvet A, Planques B, Dussaucy M, Chatelain J, Beardty P, Launay J-M (1993) A new point mutation in the prion protein gene at codon 210 in Creutzfeldt-Jakob disease. Neurology 43:1934-1938.
(c) 1996 WILEY-LISS, INC.
ZR 8
MH Alleles; Base Sequence; DNA Restriction Enzymes/metabolism; Exons/genetics; Human; Introns/*genetics; Molecular Sequence Data; Mutation/*genetics; Oligodeoxyribonucleotides; Prion Diseases/diagnosis/genetics; Prions/chemistry/*genetics; Sequence Analysis, DNA
SP englisch
PO USA
OR Prion-Krankheiten 6