NR AJVI
AU Raeber,A.J.; Race,R.E.; Brandner,S.; Priola,S.A.; Sailer,A.; Bessen,R.A.; Mucke,L.; Manson,J.; Aguzzi,A.; Oldstone,M.B.A.; Weissmann,C.; Chesebro,B.
TI Astrocyte-specific expression of hamster prion protein (PrP) renders PrP knockout mice susceptible to hamster scrapie
QU EMBO Journal 1997 Oct 15; 16(20): 6057-65
PT journal article
AB Transmissible spongiform encephalopathies are characterized by spongiosis, astrocytosis and accumulation of PrPsc, an isoform of the normal host protein PrPc. The exact cell types responsible for agent propagation and pathogenesis are still uncertain. To determine the possible role of astrocytes, we generated mice devoid of murine PrP but expressing hamster PrP transgenes driven by the astrocyte-specific GFAP promoter. After inoculation with hamster scrapie, these mice accumulated infectivity and PrPsc to high levels, developed severe disease after 227 +/- 5 days and died 7 +/- 4 days later. Therefore, astrocytes could play an important role in scrapie pathogenesis, possibly by an indirect toxic effect on neurons. Interestingly, mice expressing the same transgenes but also endogenous murine PrP genes propagated infectivity without developing disease.
VT
Introduction
Transmissible spongiform encephalopathies (TSEs) are degenerative disorders of the central nervous system (CNS) which occur naturally in man and in a variety of other animals. They include scrapie of sheep and goats, bovine spongiform encephalopathy (BSE) in cattle and several human diseases such as Creutzfeldt-Jakob disease (CJD), Kuru, Gerstmann-Sträussler-Scheinker syndrome (GSS) and fatal familial insomnia (FFI) (Pocchiari, 1994; Prusiner, 1996; Caughey and Chesebro, 1997). Since its first recognition in 1986, BSE has acquired epidemic proportions in the UK (Wilesmith, 1992), and the recent appearance of a new variant of CJD (vCJD) has raised concern that BSE might be communicable to humans (Will et al., 1996). One of the hallmarks of TSE is the accumulation in the brain of a protease-resistant protein, PrPsc or PrPres, which is derived by a poorly understood post-translational event from a normal host-encoded protease-sensitive isoform, designated PrPc or PrP-sen (Chesebro et al., 1985; Oesch et al., 1985; Basler et al., 1986). PrPc is attached by a glycolipid anchor to the cell surface (Stahl et al., 1987) and is expressed by many cell types, including neurons (Kretzschmar et al., 1986), astrocytes (Moser et al., 1995 ; van Keulen et al., 1995), lymphocytes (Cashman et al., 1990), follicular dendritic cells (McBride et al., 1992) and tumor cell lines of various lineages (Caughey et al., 1988). Brain-derived preparations highly enriched for scrapie infectivity contain PrPsc as a major protein component (Bolton et al., 1982), but no scrapie-specific nucleic acid has been detected (Kellings et al., 1993). Prusiner suggested that the etiologic agent of TSE might be PrPsc itself (Prusiner, 1982) and that agent propagation might occur by a mechanism of PrPsc induced conformational transition of PrPc into new PrPsc molecules (Prusiner, 1989, 1991, 1993; Caughey et al., 1991; Pan et al., 1993).
Mice devoid of functional PrP genes are resistant to scrapie and unable to propagate the agent (Büeler et al., 1993; Sailer et al., 1994). Efficient cross-species transmission of TSE is dependent on expression of PrP from the same species as the source of the challenge TSE agent (Scott et al., 1989; Prusiner et al., 1990). Introduction of hamster PrP (HaPrP) transgenes into PrP null mice restores susceptibility to hamster scrapie but not to mouse scrapie, and vice versa (Büeler et al., 1993; Fischer et al., 1996).
The cell types involved in agent propagation have not been completely identified. Some data indicate that in the spleen (where in most models of scrapie, accumulation of scrapie agent is first detected), the follicular dendritic cells constitute the pathogenetic compartment (Kitamoto et al., 1991; McBride et al., 1992). It is generally assumed that agent propagation and pathology in the brain is neuron-dependent, and it was recently shown that transgenic mice expressing a hamster PrP minigene under the control of the neuron-specific enolase (NSE) promoter are highly susceptible to the hamster scrapie agent (Race et al., 1995). In these mice, HaPrP expression was found exclusively in neurons and not in glial cells or cells within the spleen or lymph nodes. Thus, neuron-specific PrP expression is sufficient to sustain scrapie infection, and PrP expression in non-neuronal cells, in particular astrocytes and cells of the lymphoreticular system, is not required, at least in the case of intracerebral inoculation.
The possibility that astrocytes might also contribute to the natural disease process is suggested by the findings that astrocytes express PrP (Moser et al., 1995), and that in at least one model they are also the earliest site of PrPsc accumulation in the brain (Diedrich et al., 1991). Here we show that PrP knockout mice transgenic for an HaPrP gene under control of the glial fibrillary acidic protein (GFAP) gene promoter express PrP predominantly if not exclusively in astrocytes, and are susceptible to intracerebral inoculation with hamster scrapie agent. These mice accumulate protease-resistant HaPrP and high titers of hamster scrapie agent in their brains, and show pathological changes similar to those of non-transgenic wild-type mice inoculated with mouse scrapie. Interestingly, mice expressing the same transgenes as well as endogenous murine PrP genes propagated infectivity without developing disease.
Results
Generation and characterization of GFAP-HaPrP transgenic mice
To investigate whether astrocyte-restricted expression of HaPrP suffices to render mice susceptible to hamster scrapie agent, transgenic mice were generated in which a 1 kb cDNA encompassing the entire HaPrP open reading frame was expressed under control of the glial fibrillary acidic protein (GFAP) promoter (Johnson et al., 1995) (Figure 1A). Transgene-positive founder mice were bred to C57Bl/10 mice and positive F1 progeny were identified. Among five independent founder lines, Tg3 mice showed the highest level of PrP expression in the brain (Figure 1B). These mice expressed HaPrP mRNA in the brain (Figure 1C). Western analysis revealed HaPrP protein in the brain but not in spleen, heart, lung, thymus, muscle, liver or kidney (Figure 1D). Tg3 mice were crossed with PrP null (Prnp0/0) mice (Büeler et al., 1992) to yield Tg3/Prnp0/+ offspring which were intercrossed to produce Tg3/Prnp0/0 mice. In initial experiments, the HaPrP mRNA expression level in the brains of these mice was below detectability by in situ hybridization. Therefore, we examined the cell specificity of HaPrP expression after cryolesion-mediated upregulation of GFAP-directed transgene expression (Johnson et al., 1995). Brain sections from Tg3/Prnp0/0 mice sacrificed 48 h after cryolesioning were subjected to in situ hybridization for HaPrP followed by immunohistochemistry for GFAP. As shown in Figure 2G, cells in the vicinity of the lesion that contained PrP mRNA also expressed GFAP. In GFAP-positive cells of the hippocampus (Figure 2D), PrP mRNA was expressed to a lesser extent, perhaps because of its distance from the lesioned site or because GFAP protein is more stable than PrP mRNA. For comparison, Figure 2 shows that in the hippocampal formation and also in the cerebral cortex of Prnp+/+ mice, neurons were strongly positive for PrP mRNA, while no PrP transcripts were detected in brains of non-transgenic Prnp0/0 mice (compare panels F and I with E and H). These findings indicated that in the brain, the GFAP-HaPrP transgene was expressed only in astrocytes. Experiments were then initiated to study the susceptibility of these mice to hamster scrapie agent.
Susceptibility of GFAP-HaPrP transgenic mice to hamster scrapie
When Tg3 mice and non-transgenic littermates were inoculated with hamster scrapie agent (strain 263K), neither group developed disease by as late as 750 days after inoculation, whereas all hamsters which were similarly inoculated died of scrapie by 77 +/- 3 days (Figure 3). In contrast, when Tg3/Prnp0/0 mice were challenged with hamster scrapie, the mice developed severe scrapie symptoms consisting of ataxia, paralysis, kyphosis, foot clasp reflex, mincing gait and disorientation around 227 +/- 5 days, and died at 233 +/- 3 days post-inoculation. Interestingly, disease in these mice presented with a short clinical disease period of only 7 +/- 4 days, as compared with 13 +/- 11 days for wild-type (CD-1) mice inoculated with RML mouse scrapie (Büeler et al., 1994), suggesting unusual kinetics of the onset and development of pathogenic processes. In a second experiment, the Tg3 transgenes were introduced into PrP knockout mice on a different genetic background (129/Ola) (Manson et al., 1994a), to yield RML-Tg3/Prnp-/- mice. After inoculation with hamster scrapie agent (strain 263K), 9 out of 12 mice developed disease and died as in the previous experiment, one animal developed disease 462 days after inoculation and two mice which did not show clinical symptoms were sacrificed 564 days after inoculation and found to have high levels of PrPsc in their brains. Thus, in almost all cases, expression of HaPrP in astrocytes was sufficient to confer susceptibility to clinical disease in Prnp0/0 mice, but not in Prnp+/+ mice. These results demonstrated the profound influence of endogenous murine PrPc on the susceptibility of HaPrP-transgenic mice to hamster scrapie agent; similar interference of endogenous murine PrP with pathogenicity of TSE agents from other species has been described previously (Scott et al., 1989; Race et al., 1995; Telling et al., 1996).
------------------------------------------------------------------------
Fig. 1. Structure of the GFAP-HaPrP transgene and characterization of the transgenic mice. (A) Partial structure of the GFAP-HaPrP transgene and predicted mRNA. A 1.2 kb fragment of hamster PrP (HaPrP) cDNA (Robakis et al., 1986) containing the open reading frame, some untranslated PrP sequences and Bluescript polylinker sequences was used to replace the lacZ gene between the NotI sites in clone C-445 (Johnson et al., 1995). This construct contained ~2 kb of GFAP 5['] flanking sequences, 89 residues of GFAP exon1, 0.2 kb of SV40 DNA with splice sites, the 1.2 kb HaPrP insert, 0.2 kb of SV40 DNA with a poly(A) signal sequence, followed by the remainder of the GFAP gene. This construct was expected to produce a messenger RNA of 1.8 kb, as shown. (B) Analysis of HaPrPc in brain by immunoblotting. Brain homogenates were prepared from uninfected hamsters and F1 crosses of GFAP-HaPrP transgenic founder mice with C57BL/10 mice and were analyzed by immunoblotting with HaPrP-specific monoclonal antibody 3F4. (C) Analysis of PrP mRNA in brain. mRNA from normal and Tg3 mouse brain was analyzed by Northern blotting as described in Materials and methods. A 2.3 kb mRNA representing the normal mouse PrP transcript was seen in both samples, and a 1.8 kb mRNA corresponding to the predicted transcript from the GFAP-HaPrP transgene was detected in Tg3 mice. (D) Immunoblot analysis of HaPrPc in various tissues of hamster and Tg3 transgenic mice using monoclonal antibody 3F4. Each lane contained protein derived from 5 mg of tissue.
------------------------------------------------------------------------
Protease-resistant HaPrP in transgenic GFAP-HaPrP mice
One of the hallmarks of TSE diseases is the accumulation in the brain of a protease-resistant isoform of PrP termed PrPsc. We assessed the formation of PrPsc in scrapie-infected transgenic mice by Western immunoblot analysis of brain extracts using the HaPrP-specific monoclonal antibody 3F4 (Kascsak et al., 1987). Although the level of hamster PrPc in uninfected Tg3/Prnp0/0 mice was only about 5% of the level detected in normal hamster brain (Figure 4A, lanes 1 and 5), terminally ill scrapie-inoculated Tg3/Prnp0/0 mice showed similar high levels of protease-resistant PrP to clinically ill hamsters (Figure 4B). The inordinately increased level of total HaPrP in scrapie-infected as compared with uninfected Tg3/Prnp0/0 mice (Figure 4A, compare lanes 1 and 3) could be due to increased expression of HaPrP as a consequence of astrogliosis, in addition to the accumulation of HaPrPsc. Northern blot analysis of poly(A)+ RNA showed a 2-fold increase in HaPrP transcript level in the brains of Tg3/Prnp0/0 mice in response to scrapie infection, in contrast to the levels in wild-type mice which were not altered by scrapie infection (Figure 4C, compare lanes 5 and 6 with 7 and 8).
Surprisingly, asymptomatic Tg3/Prnp+/+ mice sacrificed at 300, 630 or 750 days post-inoculation also had detectable PrPsc, but quantitation by serial dilution showed that its level was at least 100-fold lower than that observed in terminally ill hamsters or Tg3/Prnp0/0 mice (Figure 4B). A correlation between PrPsc level and clinical disease is, however, not a general finding (Büeler et al., 1994; Collinge et al., 1995 ; Telling et al., 1996).
------------------------------------------------------------------------
Fig. 2. Brain sections doubly labeled for PrP mRNA and GFAP.
Double labeling of Prnp mRNA (black) and GFAP (red) on sections of cryolesioned brain of Tg3/Prnp0/0 mice (left column), Prnp0/0 mice (middle column) and wild-type mice (right column) 48 h after cryolesioning (Phillips et al., 1995) of the right frontoparietal cortex (duration 60 s). At low power magnification (A, B and C), the necrotic zone and the penumbra of the cryolesion appear demarcated by reactive astrocytes. Labeled rectangles indicate the detailed view of the respective area, hippocampus or penumbra zone of the cortex. In Tg3/Prnp0/0 mice, coexpression of HaPrP mRNA (black) and GFAP (red) is visible after strong activation of the GFAP promoter in the penumbra zone of the cryolesion (G), while HaPrP mRNA is barely detectable in resting astrocytes (D). Prnp0/0 mice show activated astrocytes around cryolesioned areas (H) and resting astrocytes in the hippocampus (E), but no PrP mRNA. Wild-type mice show PrP mRNA in hippocampal (F) and cortical neurons (I) but not in activated (I) or resting (F) astrocytes.
------------------------------------------------------------------------
Propagation of hamster scrapie agent in transgenic GFAP-HaPrP mice
To determine whether hamster scrapie agent was propagated in the brains of asymptomatic Tg3/Prnp+/+ mice or non-transgenic littermates, brain homogenates from animals sacrificed at various times after inoculation were injected intracerebrally into hamsters. Recipients of brain homogenate from Tg3/Prnp+/+ mice died after 90-95 days, which corresponds to a titer of ~2x10hoch7-2x10hoch8 LD50 units/g of brain tissue, whereas samples from clinically ill Tg3/Prnp0/0 mice had 2x10hoch9-2x10hoch10 LD50 units/g (Table I). In contrast, non-transgenic control mice had much less hamster scrapie infectivity, corresponding to a level of 20-2000 LD50 units/g. Thus, the presence of normal mouse PrP reduced formation of HaPrPsc and hamster scrapie infectivity and prevented clinical disease in Tg3/Prnp+/+ mice.
Low levels of hamster scrapie infectivity were detected in the spleen of a Tg3/Prnp0/0 mouse sacrificed 233 days after intracerebral (i.c.) inoculation. This could either be due to transport of residual inoculum or of scrapie agent formed in the CNS to the lymphoreticular system, or represent propagation of infectivity in the spleen. The latter interpretation, if correct, could be explained by the presence of low levels of HaPrP mRNA in the spleens of both uninfected and scrapie-infected Tg3/Prnp0/0 mice. The GFAP promoter is therefore active in spleen tissue, as shown by the presence of low levels of GFAP mRNA in wild-type spleen (Figure 4C, lanes 1 and 2) and in Tg3/Prnp0/0 spleen (lanes 3 and 4, visible on the original film but not in the photograph).
------------------------------------------------------------------------
Fig. 3. Kinetics of death due to scrapie of animals inoculated intracerebrally with hamster scrapie agent. ([bullet]) Hamsters (N = 13) inoculated with strain 263K. ([open circle]) RML-Tg3/Prnp-/- mice (N = 12) inoculated with strain 263K. One mouse developed scrapie-like disease 462 days post-inoculation (arrow) and was sacrificed 564 days after inoculation. No PrPsc was detected in the brain of this mouse. Two mice were sacrificed 564 days after inoculation (arrowhead). Both of these mice had PrPsc levels in their brains similar to a scrapie sick hamster. One of these mice was listless and ataxic; this same mouse had collapsed cerebral hemispheres at necropsy. The other mouse was listless but did not show any other clinical symptoms. ([black-square]) Zürich-Tg3/Prnp0/0 mice (N = 8) inoculated with strain Sc237. ([black-triangle]) Non-transgenic mice C57BL/10 (N = 10) inoculated with 263K showed no clinical disease during the period of observation (750 days). 'Death times' represent interval to a moribund condition or in a few cases, to actual death.
------------------------------------------------------------------------
Neuropathology in scrapie-inoculated mice
In the brains of clinically ill Tg3/Prnp0/0 mice inoculated with hamster agent, spongiform changes and pronounced astrogliosis were found predominantly in the neocortex and hippocampus, with no significant difference between Tg3/Prnp0/0 transgenic mice inoculated with hamster scrapie and normal mice inoculated with mouse scrapie (Figure 5). Therefore, typical scrapie neuropathology could be observed when PrP was expressed in astrocytes and not in neurons.
------------------------------------------------------------------------
Fig. 4. Detection of HaPrPsc and PrP mRNA in organ homogenates.
(A) Western analysis of proteinase K-digested samples (even-numbered lanes) and untreated samples (odd-numbered lanes). Lanes 1-4, Tg3/Prnp0/0 mouse uninoculated (lanes 1 and 2) or inoculated with Sc237 hamster scrapie agent and terminally scrapie sick (lanes 3 and 4). Lanes 5-8, hamster uninoculated (lanes 5 and 6) or inoculated and terminally scrapie sick (lanes 7 and 8). Lane 9, Prnp0/0 mouse, not inoculated. Molecular weight markers are depicted on the left with molecular masses expressed in kDa. (B) Western analysis of serial 5-fold dilutions of proteinase K-treated brain extracts from hamsters [75 days post-inoculation (d)], Tg3 (Prnp+/+) mice (630 d and 750 d), and from Tg3/Prnp0/0 (231 d). Molecular weight markers are indicated on the left with molecular masses expressed in KDa. (C) Northern analysis of poly(A)+ RNA (equivalent of 50 µg of total RNA per lane) in spleens (lanes 1-4) and brains (lanes 5-9) of wild-type mice uninoculated (lanes 1 and 5) or inoculated with RML mouse scrapie agent and terminally scrapie sick (lanes 2 and 6) and Tg3/Prnp0/0 mice uninoculated (lanes 3 and 7) or inoculated with Sc237 hamster scrapie agent and terminally sick (lanes 4 and 8). Lane 9, brain of Prnp0/0, not inoculated. After autoradiography the filter was stripped and successively hybridized with a GFAP and a GAPDH probe.
[View Larger Version of this Image (46K GIF file)]
------------------------------------------------------------------------
Discussion
Spongiosis, astrocytosis and accumulation of PrPsc are the most prominent neuropathological features associated with TSEs; neuronal loss is not consistently found in mouse scrapie (Scott and Fraser, 1984; S.Brandner, unpublished observations). While neurons are clearly affected in the disease process, it is still unclear whether other brain cells also play a role. Recently it was demonstrated that neuron-specific expression of HaPrP driven by the NSE promoter in transgenic mice is sufficient to mediate susceptibility to hamster scrapie (Race et al., 1995). However, astrocytes may also participate in scrapie pathogenesis because these cells show marked morphological abnormalities early in the disease process (Pattison, 1965; Eklund et al., 1967), and may in some cases be the earliest site of accumulation of PrPsc in the brain (Diedrich et al., 1991).
------------------------------------------------------------------------
Table I. Bioassay of hamster scrapie infectivity from mouse brains
Donor genotype(a) Organ Days Log10 Days to death(c) LD50/g
p.i. dilution(b)
Prnp+/+ (non-tg) brain 300 -2 178 ± 14(3) 2.10hoch1
Prnp+/+ (non-tg) brain 630 -2 123 ± 23(15) 2.10hoch3
Tg3/Prnp+/+ brain 300 -2 95 ± 3(10) 2.10hoch7
Tg3/Prnp+/+ brain 630 -2 90 ± 2(12) 2.10hoch8
Tg3/Prnp0/0 brain 231 -3 83 ± 4(5) 2.10hoch10
Tg3/Prnp0/0 brain 233 -3 90 ± 4(6) 2.10hoch9
Tg3/Prnp0/0 brain 235 -3 91 ± 5(6) 2.10hoch9
Tg3/Prnp0/0 spleen 233 -2 212 ± 16(3) 1-10
Hamster brain 75 -3 83 ± 2(6) 2.10hoch10
a Donor animals were inoculated i.c. with hamster scrapie agent as described in Materials and methods.
b 10% (w/v) suspensions of tissue in either 0.32 M sucrose or 10 mM Tris-HCl, 5 mM MgCl2 (= 10-1 dilution) were made, and the dilutions indicated in the table were inoculated i.c. into hamsters.
c Mean days to death ± standard deviation (number of hamsters inoculated). All inoculated hamsters died of scrapie.
------------------------------------------------------------------------
In the present paper we report on transgenic mice expressing HaPrP under control of the GFAP promoter. The GFAP expression vector used for generating GFAP-HaPrP transgenic mice was shown previously to confer astrocyte-specific expression upon a lacZ reporter transgene (Mucke et al., 1991). In these experiments, lacZ expression was restricted to astrocytes in the CNS and lens epithelium, and was not observed in neurons or in other tissues including spleen, lymph node and sciatic nerve. In the GFAP-HaPrP mice described in the present report, HaPrP protein was found only in the brain and was below detection levels in other tissues. Although the constitutive level of HaPrP in the brains of transgenic mice was only ~5% of that observed in normal hamster brain, the GFAP-HaPrP transgene was up-regulated after cryolesioning and after infection with hamster scrapie. Within the limits of detection in vivo, HaPrP mRNA co-localized exclusively with GFAP-positive cells in brain sections of Tg3/Prnp0/0 mice, as expected from the astrocyte specificity of the GFAP promoter (Johnson et al., 1995). There was no evidence for HaPrP expression in neurons, and if any occurred, it would be at very low levels and unlikely to contribute to pathogenesis. No HaPrP protein was seen in spleen by immunoblotting, although HaPrP mRNA was detected at low levels.
------------------------------------------------------------------------
Fig. 5. Neuropathology in terminally ill scrapie-infected mice.
Hematoxylin and eosin staining (A-C) and GFAP immunohistochemistry (D-F) of the hippocampus of a Sc237 hamster scrapie-inoculated Tg3/Prnp0/0 mouse (238 days post-inoculation) (A and D), wild-type mouse inoculated with RML mouse scrapie (166 days post inoculation) (B and E) and RML-inoculated Prnp0/0 mouse (365 days post inoculation) (C and F). Prominent spongiosis and gliosis were found in the brains of scrapie-infected transgenic and wild-type mice. Histopathological analyses were performed when mice showed clinical symptoms of scrapie. No notable differences in the pathological changes between transgenic and wild-type mice were observed.
------------------------------------------------------------------------
Inoculation of Tg3/Prnp0/0 mice with hamster scrapie agent resulted in neurological disease after a relatively long incubation time of 227 days. This was not unexpected in view of the dependence of incubation time on PrPc expression levels (Prusiner et al., 1990; Büeler et al., 1994; Manson et al., 1994b; Fischer et al., 1996). More surprising was the rapid progression of the clinical phase leading to death of all animals within about a week. This might be explained by the inducible nature of the GFAP-HaPrP transgene leading to increased levels of HaPrPc after astrocyte activation, thereby providing more substrate for the conversion of HaPrPc into HaPrPsc.
In the present experiments, expression of mouse PrP in GFAP-HaPrP transgenic mice completely prevented clinical disease, and diminished HaPrPsc formation and propagation of hamster scrapie agent. Similar competitive or inhibitory effects between coexpressed PrP molecules of different species have been noted previously both in transgenic mice (Scott et al., 1989, 1992; Telling et al., 1996) and in mouse neuroblastoma cell cultures (Scott et al., 1992; Priola et al., 1994; Priola and Chesebro, 1995 ; Race et al., 1995) These results indicate, once more (Büeler et al., 1994; Manson et al., 1994b), that agent propagation to high levels is not necessarily sufficient to cause pathology or clinical symptoms.
In the course of the disease in wild-type mice, PrPsc has been found to accumulate in astrocytes prior to the development of neuropathological changes (Diedrich et al., 1991), suggesting that PrPsc released into the extracellular compartment (Jeffrey et al., 1994) might contribute to pathogenesis by inherent toxicity. However, as shown recently (Brandner et al., 1996), PrPsc was unable to elicit a neurotoxic effect when presented to PrP0/0 neural tissue; neurotoxicity only resulted when cells were PrP+/+ and thus able to produce PrPsc endogenously. Tg3/Prnp0/0 mice express HaPrPc in astrocytes but not in neurons, and therefore in these animals only astrocytes should be susceptible to direct pathological effects mediated by PrPsc. However, because astrocytes are involved in maintaining the normal status of neurons (Mucke and Eddleston, 1993), astrocyte dysfunction might result in neuronal abnormalities. Interestingly, onset and development of neuropathological changes in scrapie correlate with increased expression of a variety of cytokines (Campbell et al., 1994; Williams et al., 1994). Such cytokines might be produced by astrocytes or other glial cells, and might play a key role in the pathological events of scrapie via indirect effects leading to neuronal dysfunction, analogous to that which has been seen following infection of glial cells by murine retroviruses which cause a spongiform pathology quite like scrapie (Lynch et al., 1991).
Our findings that astrocytosis and spongiosis in the terminal phase of scrapie are quite similar in wild-type mice and in mice expressing PrP in either neurons or astrocytes only, suggest that a common final pathway, perhaps cytokine overproduction, contributes to the neuropathological picture in all these cases.
------------------------------------------------------------------------
Materials and methods
Generation of transgenic mice
A 1 kb fragment of hamster PrP cDNA containing the open reading frame was cloned into pBluescript-KS+ to generate plasmid p2-17, as described previously (Race et al., 1995). A NotI linker was added at the KpnI site in the polylinker and a 1.2 kb fragment was excised with NotI and inserted in place of the lacZ gene in clone C-445 containing a modified GFAP gene (Johnson et al., 1995). Digestion of this plasmid with SfiI to remove the vector sequences yielded the DNA fragment used to generate GFAP-HaPrP transgenic mice. Microinjection into pronuclei of fertilized oocytes was according to standard procedures. Transgene-positive founders were identified by semiquantitative dot blot hybridization and further characterized by Southern analysis of tail DNA, using an HaPrP DNA probe. Five lines (Tg3 to Tg7) had about two to four transgene copies. Tg3 mice were crossed with Prnp0/0 mice (Büeler et al., 1992) in Zürich and with Prnp-/- mice (Manson et al., 1994a) at RML; F3 PrP knockout progeny carrying the hamster PrP transgenes were identified by hamster-specific PCR on tail DNA. In Zürich, two separate PCRs were performed; the mouse Prnp0 and Prnp+ alleles were detected by the three primers RK1, RK2 and RK3 (Prusiner et al., 1993), and the hamster PrP transgene was amplified using the two primers GFAP1 (5['])AACCGTTACCCACCTCAGGGT and GFAP2 (5['])CTCCTTCTGATACTGGGTGGT to yield a 521 bp product. The reactions were performed in 25 µl containing 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM dNTP, 50 µM of each primer and 0.1 units SuperTaq DNA polymerase. Amplification was carried out by cycling 35 times for 1 min at 94°, 1 min at 60° and for 45 s at 72°. At RML, three reactions were used. One of the reactions identified mice positive for HaPrP. The oligonucleotide sequences and reaction conditions have been described (Race et al., 1995). A second set of oligonucleotide primers specific for a portion of the neomycin resistance gene was used to identify mice containing the disrupted non-functional mouse (Mo) PrP gene (3[']-CTTGGACGCACGTTAGGTAG-5[']) and (5 [']-TTGAGCCTGGCGAACAGTTC-3[']). The third set of primers, specific for MoPrP, distinguished mice heterozygous for the disrupted MoPrP from those homozygous for the disrupted MoPrP gene (5[']AACCGTTACCCACCTCAGGGT-3[']) and (3[']-ACACTTCTACTACCTCGCG-5[']). The same conditions were used for all three PCRs.
Sources of infectious scrapie agent
RML (Chandler, 1961) is a mouse-adapted scrapie isolate which was passaged in Swiss CD-1 mice obtained from Charles River Laboratories. The Syrian hamster-adapted isolate of scrapie strain 263K (Kimberlin and Walker, 1978) was passaged repeatedly in Golden Syrian hamsters. The Sc237 isolate (Scott et al., 1989) was provided by S.B.Prusiner.
Scrapie infection and diagnosis
Hamsters and mice were inoculated i.c. with 50 and 30 µl, respectively, of a 1% brain suspension of scrapie-infected hamster brain. Brain homogenates were made from several of the Tg3/Prnp0/0 and Tg3/Prnp+/+ mice at different times after inoculation. To titrate the levels of infectivity, 50 µl of various dilutions of these brain homogenates were inoculated i.c. into weanling Syrian hamsters which were then inspected two or three times per week for the appearance of scrapie symptoms.
Northern analysis
For the experiment in Figure 1C, brain poly(A)+ RNA was isolated using a micro Fast-Track kit (Invitrogen) and was analyzed as previously described (Race et al., 1995). For Figure 4C, total brain RNA was prepared as described previously (Chomczynski and Sacchi, 1987), and poly(A)+ RNA was isolated using oligo-(dT) latex beads (Qiagen) according to the manufacturer's instructions. Poly(A)+ RNA was denatured, electrophoresed through 2.2 M formaldehyde-1% agarose gels and blotted onto Hybond-N+ (Amersham) membranes in 20x SSC. Prehybridization and hybridization were performed with Quickhyb (Stratagene) according to the manufacturer's instructions. The membranes were probed with the 256 bp KpnI-BstEII fragment of the hamster PrP ORF which was 32P-labeled by the random primer method (Prime-It, Stratagene). GFAP mRNA was detected with a mouse GFAP cDNA probe (a kind gift from U.Pott, Brain Research Institute, University of Zürich). For glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA as an internal standard, the 490 bp XhoII fragment from rat GAPDH subcloned into pSP64 was used as a probe (Fort et al., 1985).
Western blot analysis
For Figure 1B and D and Figure 4B, proteins were analyzed by immunoblot as previously described (Race et al., 1995). For Figure 4A, 10% brain homogenates were prepared in PBS containing 0.5% NP40 and 0.5% sodium deoxycholate by passing the brains through 18-gauge and 22-gauge needles. The homogenate was centrifuged at 1500 g for 10 min, and the supernatant was adjusted to 8 mg/ml of total protein using the BCA protein assay according to the manufacturer's instruction (Pierce). Where indicated, aliquots of the homogenate were digested with 20 µg/ml proteinase K for 30 min at 37°, and the reactions were stopped by adding PMSF to 2 mM and boiling in SDS-PAGE loading buffer without [beta]-mercaptoethanol. The samples (80 µg of total protein) were electrophoresed through 12% SDS-polyacrylamide gels. Proteins were transferred to nitrocellulose membranes and probed with monoclonal antibody to hamster PrP [3F4, 1:10000 (Kascsak et al., 1987)], developed using the enhanced chemiluminescence kit (Amersham) and exposed to Kodak X-ray film.
In situ hybridization
In situ hybridization for PrP RNA was performed on selected brain sections. The 290 bp (Asp718-BstEII) fragment of mouse PrP cDNA was cloned into pBluescript KS and SK vector (Stratagene, La Jolla, CA), respectively. Digoxygenin-labeled sense and antisense probes were synthesized (Boehringer, Mannheim) from the Asp718-cleaved KS and SK constructs, respectively, using T3 RNA polymerase. Sections were deparaffinized and postfixed in 4% paraformaldehyde in PBS, mildly digested with proteinase K (10 µg/ml for 5 min at 37°) and permeabilized for 10 min in 0.1 M HCl. After a second fixation step in 4% paraformaldehyde for 10 min, acetylation was performed in triethanolamine 0.1 M, acetic anhydride 0.25% and prehybridization was carried out in 5x SSC, 50% formamide, 5x Denhardt's and 250 µg/ml yeast tRNA for 3-5 h at room temperature. Hybridization was in the same mixture containing the digoxygenin-labeled probe at 200-400 ng/ml for 12 h at 65°. The sample was washed for 1 h at 65° in 0.2x SSC, labeled with anti-DIG Fab fragments (1:500) and developed with 5-bromo-4-chloro-3-indolyl phosphate and 4-nitroblue tetrazolium chloride following the supplier's protocol. For subsequent GFAP immunolabeling, sections were heated to 80° to inactivate alkaline phosphatase and processed as described below. The sections were mounted in glycerol-gelatin.
Immunohistochemistry
For paraffin histology, whole mouse brains were fixed for at least 24 h in 4% paraformaldehyde in phosphate-buffered saline (PBS), immersed for 1 h in 98% formic acid and postfixed for 72 h in 4% paraformaldehyde/PBS. Coronal slices of ~2 mm thickness were dehydrated through graded alcohols and embedded in paraffin. Sections of 4 µm nominal thickness were mounted on TESPA (SIGMA Chemicals)-coated glass slides and routinely stained with hematoxylin and eosin (H&E). Immunohistochemistry for GFAP [polyclonal, 1:300 (Dako, Glostrup, DK)] was performed on paraffin-embedded sections. Biotinylated secondary antibodies (goat anti-rabbit; DAKO) were used at a dilution of 1:200. Visualization was achieved using biotin/avidin-peroxidase (DAKO) and diaminobenzidine as a chromogen following the protocols suggested by the manufacturer. Alkaline phosphatase-labeled secondary antibodies (rabbit anti-mouse, DAKO) were used at a 1:30 dilution and visualized by the new fuchsin color reaction according to manufacturer's protocol.
Acknowledgements
The authors thank Janel Docker, Istvan Vajtai and Darwin Ernst for technical assistance. This work was supported by the Kanton of Zürich, by grants from the Swiss National Science Foundation to C.W. and A.A., from the European Union to A.A., from the Human Frontiers Program to C.W. and by grant AG04342 from the National Institutes of Health to M.B.A.O. and L.M.
This paper is publication #10453-NP from the Scripps Research Institute.
------------------------------------------------------------------------
References
* Basler, K. , Oesch, B. , Scott, M. , Westaway, D. , Wälchli, M. , Groth, D.F. , McKinley, M.P. , Prusiner, S.B. and Weissmann, C. (1986) Scrapie and cellular PrP isoforms are encoded by the same chromosomal gene. Cell, 46, 417-428
* Bolton, D.C. , McKinley, M.P. and Prusiner, S.B. (1982) Identification of a protein that purifies with the scrapie prion. Science, 218, 1309-1311
* Brandner, S. , Isenmann, S. , Raeber, A. , Fischer, M. , Sailer, A. , Kobayashi, Y. , Marino, S. , Weissmann, C. and Aguzzi, A. (1996) Normal host prion protein necessary for scrapie-induced neurotoxicity. Nature, 379, 339-343
* Büeler, H. , Fischer, M. , Lang, Y. , Bluethmann, H. , Lipp, H.-P. , DeArmond, S.J. , Prusiner, S.B. , Aguet, M. and Weissmann, C. (1992) Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein. Nature, 356, 577-582
* Büeler, H. , Aguzzi, A. , Sailer, A. , Greiner, R.A. , Autenried, P. , Aguet, M. and Weissmann, C. (1993) Mice devoid of PrP are resistant to scrapie. Cell, 73, 1339-1347
* Büeler, H. , Raeber, A. , Sailer, A. , Fischer, M. , Aguzzi, A. and Weissmann, C. (1994) High prion and PrPsc levels but delayed onset of disease in scrapie-inoculated mice heterozygous for a disrupted PrP gene. Mol. Med., 1, 19-30
* Campbell, I.L. , Eddleston, M. , Kemper, P. , Oldstone, M.B. and Hobbs, M.V. (1994) . Activation of cerebral cytokine gene expression and its correlation with onset of reactive astrocyte and acute-phase response gene expression in scrapie. J. Virol., 68, 2383-2387
* Cashman, N.R. , Loertscher, R. , Nalbantoglu, J. , Shaw, I. , Kascsak, R.J. , Bolton, D.C. and Bendheim, P.E. (1990) Cellular isoform of the scrapie agent protein participates in lymphocyte activation. Cell, 61, 185-192
* Caughey, B. and Chesebro, B. (1997) Prion protein and the transmissible spongiform encephalopathies. Trends Cell Biol., 7, 56-62
* Caughey, B. , Race, R.E. and Chesebro, B. (1988) Detection of prion protein mRNA in normal and scrapie-infected tissues and cell lines. J. Gen. Virol., 69, 711-716
* Caughey, B.W. , Dong, A. , Bhat, K.S. , Ernst, D. , Hayes, S.F. and Caughey, W.S. (1991) Secondary structure analysis of the scrapie-associated protein PrP 27-30 in water by infrared spectroscopy. Biochemistry, 30, 7672-7680
* Chandler, R.L. (1961) Encephalopathy in mice produced by inoculation with scrapie brain material. Lancet, i, 1378-1379
* Chesebro, B. , Race, R. , Wehrly, K. , Nishio, J. , Bloom, M. , Lechner, D. , Bergstrom, S. , Robbins, K. , Mayer, L. , Keith, J.M. , Garon, C. and Haase, A. (1985) Identification of scrapie prion protein-specific messenger RNA in scrapie-infected and uninfected brain. Nature, 315, 331-333
* Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159
* Collinge, J. , Palmer, M.S. , Sidle, K.C. , Gowland, I. , Medori, R. , Ironside, J. and Lantos, P. (1995) Transmission of fatal familial insomnia to laboratory animals. Lancet, 346, 569-570
* Diedrich, J.F. , Bendheim, P.E. , Kim, Y.S. , Carp, R.I. and Haase, A.T. (1991) Scrapie-associated prion protein accumulates in astrocytes during scrapie infection. Proc. Natl Acad. Sci. USA, 88, 375-379
* Eklund, C.M. , Kennedy, R.C. and Hadlow, W.J. (1967) Pathogenesis of scrapie virus infection in the mouse. J. Infect. Dis., 117, 15-22
* Fischer, M. , Rülicke, T. , Raeber, A. , Sailer, A. , Moser, M. , Oesch, B. , Brandner, S. , Aguzzi, A. and Weissmann, C. (1996) Prion protein (PrP) with amino-proximal deletions restoring susceptibility of PrP knockout mice to scrapie. EMBO J., 15, 1255-1264
* Fort, P. , Marty, L. , Piechaczyk, M. , El, S.S. , Dani, C. , Jeanteur, P. and Blanchard, J.M. (1985) Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res., 13, 1431-1442
* Jeffrey, M. , Goodsir, C.M. , Bruce, M. , McBride, P.A. , Scott, J.R. and Halliday, W.G. (1994) Correlative light and electron microscopy studies of PrP localisation in 87V scrapie. Brain Res., 656, 329-343
* Johnson, W.B. , Ruppe, M.D. , Rockenstein, E.M. , Price, J. , Sarthy, V.P. , Verderber, L.C. and Mucke, L. (1995) Indicator expression directed by regulatory sequences of the glial fibrillary acidic protein (GFAP) gene: in vivo comparison of distinct GFAP-lacZ transgenes. Glia, 13, 174-184
* Kascsak, R.J. , Rubenstein, R. , Merz, P.A. , Tonna, D.M. , Fersko, R. , Carp, R.I. , Wisniewski, H.M. and Diringer, H. (1987) Mouse polyclonal and monoclonal antibody to scrapie-associated fibril proteins. J. Virol., 61, 3688-3693
* Kellings, K. , Meyer, N. , Mirenda, C. , Prusiner, S.B. and Riesner, D. (1993) Analysis of nucleic acids in purified scrapie prion preparations. Arch. Virol. Suppl., 7, 215-225
* Kimberlin, R.H. and Walker, C.A. (1978) Evidence that the transmission of 1 source of scrapie agent to hamsters involves separation of agent strains from a mixture. J. Gen. Virol., 39, 487-496
* Kitamoto, T. , Muramoto, T. , Mohri, S. , Dohura, K. and Tateishi, J. (1991) Abnormal isoform of prion protein accumulates in follicular dendritic cells in mice with Creutzfeldt-Jakob disease. J. Virol., 65, 6292-6295
* Kretzschmar, H.A. , Prusiner, S.B. , Stowring, L.E. and DeArmond, S.J. (1986) Scrapie prion proteins are synthesized in neurons. Am. J. Pathol., 122, 1-5
* Lynch, W.P. , Czub, S. , McAtee, F.J. , Hayes, S.F. and Portis, J.L. (1991) Murine retrovirus-induced spongiform encephalopathy: productive infection of microglia and cerebellar neurons in accelerated CNS disease. Neuron, 7, 365-79
* Manson, J.C. , Clarke, A.R. , Hooper, M.L. , Aitchison, L. , McConnell, I. and Hope, J. (1994a) 129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal. Mol. Neurobiol., 8, 121-127
* Manson, J.C. , Clarke, A.R. , McBride, P.A. , McConnell, I. and Hope, J. (1994b) PrP gene dosage determines the timing but not the final intensity or distribution of lesions in scrapie pathology. Neurodegeneration, 3, 331-340
* McBride, P.A. , Eikelenboom, P. , Kraal, G. , Fraser, H. and Bruce, M.E. (1992) PrP protein is associated with follicular dendritic cells of spleens and lymph nodes in uninfected and scrapie-infected mice. J. Pathol., 168, 413-418
* Moser, M. , Colello, R.J. , Pott, U. and Oesch, B. (1995) Developmental expression of the prion protein gene in glial cells. Neuron, 14, 509-517
* Mucke, L. and Eddleston, M. (1993) Astrocytes in infectious and immune-mediated diseases of the central nervous system. FASEB J., 7, 1226-1232
* Mucke, L. , Oldstone, M.B. , Morris, J.C. and Nerenberg, M.I. (1991) Rapid activation of astrocyte-specific expression of GFAP-lacZ transgene by focal injury. New Biol., 3, 465-74
* Oesch, B. et. al. (1985) A cellular gene encodes scrapie PrP 27-30 protein. Cell, 40, 735-746
* Pan, K.M. et. al. (1993) Conversion of alpha-helices into beta-sheets features in the formation of the scrapie prion proteins. Proc. Natl Acad. Sci. USA, 90, 10962-10966
* Pattison,I.H. (1965) Experiments with scrapie with special reference to the nature of the agent and the pathology of the disease. In Gajdusek,D.C., Gibbs,C.J. and Alpers,M. (eds), NINDB Monograph No.2, Slow, Latent and Temperate Virus Infections. US Govt. Printing Office, Washington DC, pp. 249-257.
* Phillips, M.J. , Weller, R.O. , Kida, S. and Ianotti, F. (1995) Focal brain damage enhances experimental allergic encephalomyelitis in brain and spinal cord. Neuropathol. Appl. Neurobiol., 21, 189-200
* Pocchiari, M. (1994) Prions and related neurological diseases. Mol. Aspects Med., 15, 195-291
* Priola, S.A. and Chesebro, B. (1995) A single hamster PrP amino acid blocks conversion to protease-resistant PrP in scrapie-infected mouse neuroblastoma cells. J. Virol., 69, 7754-7758
* Priola, S.A. , Caughey, B. , Race, R.E. and Chesebro, B. (1994) Heterologous PrP molecules interfere with accumulation of protease-resistant PrP in scrapie-infected murine neuroblastoma cells. J. Virol., 68, 4873-4878
* Prusiner, S.B. (1982) Novel proteinaceous infectious particles cause scrapie. Science, 216, 136-144
* Prusiner, S.B. (1989) Scrapie prions. Annu. Rev. Microbiol., 43, 345-374
* Prusiner, S.B. (1991) Molecular biology of prion diseases. Science, 252, 1515-1522
* Prusiner, S.B. (1993) Transgenetic investigations of prion diseases of humans and animals. Philos. Trans. R. Soc. Lond. Biol., 339, 239-254
* Prusiner, S.B. (1996) Human prion diseases and neurodegeneration. Curr. Top. Microbiol. Immunol., 207, 1-17
* Prusiner, S.B. et. al. (1990) Transgenetic studies implicate interactions between homologous PrP isoforms in scrapie prion replication. Cell, 63, 673-686
* Prusiner, S.B. et. al. (1993) Ablation of the prion protein (PrP) gene in mice prevents scrapie and facilitates production of anti-PrP antibodies. Proc. Natl Acad. Sci. USA, 90, 10608-10612
* Race, R.E. et. al. (1995) Neuron-specific expression of a hamster prion protein minigene in transgenic mice induces susceptibility to hamster scrapie agent. Neuron, 15, 1183-1191
* Robakis, N.K. , Sawh, P.R. , Wolfe, G.C. , Rubenstein, R. , Carp, R.I. and Innis, M.A. (1986) Isolation of a cDNA clone encoding the leader peptide of prion protein and expression of the homologous gene in various tissues. Proc. Natl Acad. Sci. USA, 83, 6377-6381
* Sailer, A. , Büeler, H. , Fischer, M. , Aguzzi, A. and Weissmann, C. (1994) No propagation of prions in mice devoid of PrP. Cell, 77, 967-968
* Scott,J.R. and Fraser,H. (1984) Degenerative hippocampal pathology in mice infected with scrapie. Acta Neuropathol. (Berl), 65, 62-68.
* Scott, M. et. al. (1989) Transgenic mice expressing hamster prion protein produce species-specific scrapie infectivity and amyloid plaques. Cell, 59, 847-857
* Scott, M.R. , Kohler, R. , Foster, D. and Prusiner, S.B. (1992) Chimeric prion protein expression in cultured cells and transgenic mice. Protein Sci., 1, 986-997
* Stahl, N. , Borchelt, D.R. , Hsiao, K. and Prusiner, S.B. (1987) Scrapie prion protein contains a phosphatidylinositol glycolipid. Cell, 51, 229-240
* Telling, G.C. , Haga, T. , Torchia, M. , Tremblay, P. , DeArmond, S.J. and Prusiner, S.B. (1996) Interactions between wild-type and mutant prion proteins modulate neurodegeneration in transgenic mice. Genes Dev., 10, 1736-1750
* van Keulen, L.J. , Schreuder, B.E. , Meloen, R.H. , Poelen-van den Berg,M. , Mooij-Harkes, G. , Vromans, M.E. and Langeveld, J.P. (1995) Immunohistochemical detection and localization of prion protein in brain tissue of sheep with natural scrapie. Vet. Pathol., 32, 299-308
* Wilesmith, J.W. (1992) Epidemiology of bovine spongiform encephalopathy. Semin. Virol., 2, 239-245
* Will, R.G. et. al. (1996) A new variant of Creutzfeldt-Jakob disease in the UK. Lancet, 347, 921-925
* Williams, A.E. , Van, D.A.M. , Man, A.H.W.K. , Berkenbosch, F. , Eikelenboom, P. and Fraser, H. (1994) Cytokines, prostaglandins and lipocortin-1 are present in the brains of scrapie-infected mice. Brain Res., 654, 200-206
Received on February 18, 1997; revised on August 6, 1997.
AD
Alex J. Raeber, Richard E. Race1, Sebastian Brandner2, Suzette A. Priola1, Andreas Sailer3, Richard A. Bessen1, Lennart Mucke4,5, Jean Manson6, Adriano Aguzzi2, Michael B.A. Oldstone4, Charles Weissmann7 and Bruce Chesebro1
Institut für Molekularbiologie, Abteilung I, University of Zürich, Hönggerberg, 8093 Zürich, 1 Laboratory of Persistent Viral Diseases, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, Hamilton, MT 59840, USA, 2 Institut für Neuropathologie, University Hospital Zürich, 8091 Zürich, Switzerland, 4 Division of Virology, Department of Neuropharmacology, Scripps Research Institute, 10666 North Torrey Pines Road, La Jolla, CA 92037, USA and 6 Institute for Animal Health, AFRC, Edinburgh, UK 3 Present address: Molecular Neurobiology Laboratory, Salk Institute, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA 5 Present address: Gladstone Molecular Neurobiology Program, PO Box 419100, San Francisco, CA 94141, USA
7 Corresponding author: A.J.Raeber and R.E.Race contributed equally to this work, C.Weissmann and B.Chesebro share senior authorship
ZR 59 Zitate
IN Mäuse ohne eigenes Mäuseprionprotein, aber mit einem zusätzlichen Hamsterprionprotein unter der Kontrolle des Astrozyten-spezifischen GFAP-Promotors, können nach intrazerebraler Inokulation mit Hamster-Scrapie die Infektiosität und das scrapieassoziierte PrPsc akkumulieren. Sie erkrankten in einem Experiment nach 227+/-5 Tagen und starben nach 7+/-4 weiteren Tagen. Mäuse, welche eigenes Mäuseprionprotein und transgenes Hamsterprionprotein exprimieren, vermehrten zwar auch die Infektiosität, entwickelten aber nicht die Krankheit.
MH Animal; Astrocytes/*metabolism; Biological Assay; Brain/pathology; Disease Susceptibility; Glial Fibrillary Acidic Protein/genetics; Hamsters; Mice; Mice, Knockout; PrPsc Proteins/biosynthesis/genetics; Prions/*biosynthesis/genetics; RNA, Messenger/analysis; Recombinant Fusion Proteins/biosynthesis; Rodent Diseases/*etiology/mortality; Scrapie/*etiology/mortality; Support, Non-U.S. Gov't; Support, U.S. Gov't, Non-P.H.S.; Support, U.S. Gov't, P.H.S.
AD Institut für Molekularbiologie, Abteilung I, University of Zürich, H-onggerberg, 8093 Z-urich, Switzerland.
SP englisch
PO England
OR Prion-Krankheiten 7