Hypertext-Lernprogramm Eucyte

Roland Heynkes, 12.5.2019

Nach dem genialen Vorbild der TT-Programme des Klett-Verlages der 1970er Jahre soll dieses Hypertext-Lernprogramm Lernenden helfen, sich Wissen über die bekanntesten Bestandteile eukaryotischer Zelle selbst zu erarbeiten. Zu diesem Zweck ist der Lerntext so gestaltet, dass er sich möglichst individuell den Lernenden mit ihren sehr unterschiedlichen Voraussetzungen und Bedürfnissen anpasst.

Die blau umrandeten Kästen mit hellgrünem Hintergrund dienen ähnlich wie Überschriften der thematischen Orientierung.

Es folgen erklärende Texte und manchmal Bilder. Daran schließen sich die Fragen an, mit denen man sein Wissen prüfen kann.

Die blauen Tabellen enthalten unter der Frage alternative Antworten, von denen man die richtige auszusuchen versucht und diese anklickt. So springt man entweder zur nächsten Frage oder zu einer Korrektur.

Wird eine Frage falsch beantwortet, dann springt man zu einem rot umrandeten Kasten mit gelbem Hintergrund. Hier wird der Irrtum aufgeklärt. Wenn nötig, erhält man noch zusätzliche Erklärungen.

Am Ende einer Korrektur findet man ein rot umrandetes Kästchen mit hellgrünem Hintergrund. Es enthält einen Link, der zurück zur letzten Frage oder weiter zur nächsten führt.

So springt man auf direktem oder auf mehr oder weniger vielen Umwegen durch den Hypertext und erhält nur soviele Erklärungen, wie man benötigt. Wer sämtliche Fragen richtig beantworten kann, springt sehr schnell durch den Hypertext.

Dieses Lernprogramm ließe sich noch erweitern. Seine Erstellung war allerdings derart aufwändig, dass sich die Mühe für mich nicht lohnt, solange mir kein entsprechender Bedarf zurückgemeldet wird.

Die Bedeutung der Zelle für das Leben
Die erste heute noch bekannte Darstellung von Zellen
Cells von Robert Hooke
Robert Hooke, Micrographia Schema 11, Fig.1, Observ. XVIII. Of the Schematisme or Texture of Cork, and of the Cells and Pores of some other such frothy Bodies.

Als Robert Hooke 1662 mit seinem selbst gebauten Mikroskop als wahrscheinlich erster Mensch in einem Stück Kork Zellen sah, da konnte er nicht wissen, welche Bedeutung sie für alle Lebewesen haben. Heute haben wir es viel leichter, denn es gibt inzwischen vielfältige Möglichkeiten, sich über Zellen zu informieren. Die meisten Informationsquellen sind allerdings nur verständlich, wenn man bereits über Grundkenntnisse verfügt. Solches Basiswissen fragt dieser Hypertext ab und soll es wenn nötig auch vermitteln.

Welche der folgenden Antworten beschreibt die Bedeutung von Zellen für das Leben am besten?
Zellen sind die Bausteine des Lebens. Ihr Entdecker Robert Hooke nannte sie nach den Zellen in einem Kloster.
Der menschliche Körper besteht aus rund 200 verschiedenen Zelltypen, die sich alle aus der selben befruchteten Eizelle entwickeln.
Zellen sind die kleinsten lebensfähigen Einheiten. Lebewesen können nur gesund bleiben, wenn ihre Zellen und ihr Zusammenspiel perfekt funktionieren. Ihr Aufbau ist derart komplex, dass sie nicht spontan aus unbelebter Materie, sondern nur durch Teilung oder Fusion lebender Zellen entstehen können.

Antworten müssen nicht nur korrekt sein, sondern auch noch genau zur Frage passen.

Die Antwort ist inhaltlich völlig richtig. Sie erklärt aber nicht gut die Bedeutung von Zellen für das Leben.

zurück

Zellen und ihre extreme Komplexität gehören zu den Grundeigenschaften aller Lebewesen.

Zellen sind in der Tat die extrem kompliziert aufgebauten kleinsten Einheiten des Lebens. Innerlich und miteinander arbeiten sie wie perfekte Uhrwerke. Selbst die einfachsten Zellen sind so komplex, dass sich niemand wirklich vorstellen kann, wie die erste Zelle entstehen konnte. Das Staunen über das Wunder des Lebens wird umso größer, je mehr man über Zellen weiß. Dazu muss man beginnen mit dem Kennenlernen der wichtigsten Bestandteile und Vorgänge einer Zelle, wobei sich dieser Lerntext auf tierische Eukaryoten-Zellen konzentriert. Dabei kann es helfen, eine tierische Zelle mit einer Stadt zu vergleichen. Zu diesem Zweck ordnen wir verschiedenen Komponenten einer Zelle Bestandteile einer Stadt mit vergleichbaren Funktionen zu.

Was sind Organellen und Cytoplasma?
Organellen heißen die Organe der Zelle und ihre Inhalte nennt man Cytoplasma.
Organell nennt man eine strukturelle Einheit, die im strukturlos erscheinenden Grundmedium der Zelle schwimmt, das man Cytoplasma nennt.
Organellen sind funktionelle Einheiten, die im strukturlos erscheinenden Cytoplasma schwimmen.
Cytoplasma nennt man die strukturlos erscheinende gelartige Grundsubstanz einer Zelle und Organellen heißen die darin schwimmenden und von diesem abgegrenzten funktionellen Einheiten.

Cytoplasma befindet sich nur außerhalb der Organellen.

Man kann zwar die Organellen einer eukaryotischen Zelle mit den Organen eines Organismus vergleichen, aber die Organellen schwimmen im Cytoplasma und nicht umgekehrt.

zurück

Nicht jede strukturelle Einheit im Cytoplasma ist Organell.

Von einem Organell spricht man nur, wenn es vom Cytoplasma abgegrenzt ist. Zusätzlich ist ein Organell nicht nur eine strukturelle, sondern gleichzeitig auch eine funktionelle Einheit.

zurück

Nicht jede funktionelle Einheit im Cytoplasma ist Organell.

Von einem Organell spricht man nur, wenn es vom Cytoplasma abgegrenzt ist. Viele Biologen verlangen sogar, dass ein Organell durch eine Membran vom Cytoplasma getrennt ist.

zurück

Organellen sind abgetrennte Räume im strukturlos erscheinenden Cytoplasma.
Schema aus Wikimedia Commons
  1. Ein Nukleolus oder mehrere Nukleoli innerhalb des Zellkerns sind die Orte, an denen die Ribosomen aus RNA und Proteinen zusammen gesetzt werden.
  2. Zellkern (Nukleus) mit dem aus DNA bestehenden genetischen Bauplan der Zelle
  3. Als dunkle Punkte auf dem endoplasmatischen Retikulum dargestellte Ribosomen übersetzen das 4-Buchstabenalphabet der Nukleinsäuren in das 20-Aminosäuren-Alphabet der Proteine.
  4. Vesikel sind kleine Membranbläschen und dienen hauptsächlich dem Transport in der Zelle.
  5. Raues endoplasmatisches Retikulum (ER) ist mit Ribosomen besetzt.
  6. Ein Dictyosom ist einer von mehreren Membranstapeln des Golgi-Apparats
  7. Mikrotubuli sind Bestandteile des Zytoskeletts.
  8. Glattes endoplasmatisches Retikulum trägt keine Ribosomen.
  9. Mitochondrien sind die Kraftwerke der Zelle.
  10. Lysosomen werden als Verdauungsvesikel vom Golgi-Apparat abgeschnürt.
  11. Zytoplasma ist die Grundsubstanz der Zelle.
  12. Vom Endoplasmatischen Retikulum abgeschnürte Peroxisomen erzeugen und nutzen H2O2 zur Alkohol-Verdauung.
  13. Zentriole organisieren in Zellen von Tieren und niedrigen Pflanzen die Mikrotubuli.
Woland Messer, GNU Free Documentation License

Aufgrund ihrer Abgrenzung können in Organellen Prozesse ablaufen, die Bestandteile des Cytoplasmas beeinträchtigen oder selbst von diesen gestört würden. Weil die verschiedenen Organellen unterschiedliche Aufgaben haben, nennt man sie funktionelle Einheiten. Das Cytoplasma ist zwar nicht wirklich strukturlos, aber das erkennt man erst bei extremen Vergrößerungen. Aber kommen wir nun zu den einzelnen Organellen.

Welches wichtige Gebäude einer Stadt ist eher mit dem Zellkern vergleichbar?
Der Zellkern ist das Kernkraftwerk der Zelle.
Wie im Rathaus einer Stadt, so wird auch im Zellkern regiert.
Der Zellkern ist eher wie eine Bibliothek, in welcher die Zelle die gerade gesuchten Informationen findet.

Mit Energiegewinnung hat der Zellkern nichts zu tun.

Dreimal darf man raten.

zurück

Der Zellkern ist eher eine Bibliothek als ein Rathaus.

Leider ziehen die Autoren der meisten Biologiebücher aus Unkenntnis den schlechteren Vergleich mit dem Rathaus oder einer Konzernzentrale vor bzw. schreiben ohne nachzudenken von einander ab.

weiter

Der Zellkern ist die Bibliothek der Zelle.

Wäre nämlich der Zellkern das Rathaus der Zelle, dann müsste er bestimmen, was in der Zelle passiert. Mit dieser Vorstellung ließe sich aber nicht erklären, dass sich aus einer befruchteten Eizelle rund 200 sehr unterschiedliche menschliche Zelltypen entwickeln, obwohl sich in deren Zellkernen die Baupläne praktisch nicht unterscheiden. Deshalb passt viel besser der Vergleich mit einer naturwissenschaftlich oder medizinischen Bibliothek, in der man sich Kopien von den wertvollen Büchern macht, die einen gerade interessieren. In enger Abstimmung mit anderen Zellen, beeinflusst von anderen äußeren Faktoren sowie in Abhängigkeit von ihrem jeweiligen Zustand entscheidet die Zelle selbst, welche Informationen aus dem Zellkern sie nutzt. Hinzu kommen noch zahlreiche vorgeburtliche, epigenetisch wirksame Einflüsse.

Woraus besteht eigentlich die Hülle des Zellkerns?
Der Zellkern lässt sich so gut anfärben, weil seine Hülle aus Chromosomen besteht.
Die Membranen der Zellkernhülle werden von Vesikeln gebracht.
Die Hülle des Zellkerns ist gleichzeitig Teil des Endoplasmatischen Retikulums.
Der Zellkern stellt seine Hülle selbst her.

Chromosomen bilden nicht die Hülle, sondern den Inhalt des Zellkerns.

Die Hülle des Zellkerns wird von einem anderen Organell aufgebaut.

zurück

Im Gegensatz zu anderen Organellen werden die Membranen der Zellkernhülle nicht von Vesikeln geliefert.

Das ist auch nicht nowendig, weil die Zellkernhülle Teil des Organells ist, welches die Membranen selbst produziert.

zurück

Der Zellkern kann und muß seine Hülle nicht selbst herstellen.

Sie ist nämlich Bestandteil des Endoplasmatischen Retikulums.

weiter

Die Hülle des Zellkerns ist gleichzeitig Bestandteil des Endoplasmatischen Retikulums.

Dieses Organell produziert die meisten Membranen einer eukaryotischen Zelle.

Damit stellt sich die Frage, was das endoplasmatische Retikulum ist.
Das Endoplasmatische Retikulum ist ein Netzwerk innerhalb des Cytoplasmas und dient als dreidimensionales Straßennetz der Zelle.
Endoplasmatisches Retikulum heißt ein aus selbst hergestellten Membranen bestehendes Labyrinth, in das hinein Ribosomen Proteine synthetisieren. Deshalb kann man es mit einer Fabrik vergleichen.
Endoplasmatisches Retikulum nennt man die aus mehreren Dictyosomen bestehende Poststation der Zelle.

Als eine Art Straßennetz der Zelle dient das Cytoskelett.

Das Endoplasmatische Retikulum hat wichtige andere Aufgaben.

zurück

Als eine Art Poststation dient der Zelle der Golgi-Apparat.

Dieser erhält Membranen und Proteine in Form von Vesikeln vom Endoplasmatischen Retikulum, aber sie sind unterschiedliche Organellen.

zurück

Das Endoplasmatische Retikulum dient der Zelle als eine Art Fabrik.

Wie in einer Werkstatt oder Produktionshalle werden in ihm Membranen und alle Proteine hergestellt, die nicht im Inneren der Zelle bleiben sollen. Letzteres geschieht im rauen Teil des Endoplasmatischen Retikulums.

Woher kommt der Name raues endoplasmatisches Retikulum?
Es fühlt sich rauh an.
Im rauen endoplasmatischen Retikulum herrschen raue Sitten.
Auf dem rauen endoplasmatischen Retikulum sitzen Ribosomen wie Noppen.

Die Bezeichnung "rau" bezieht sich auf das Aussehen der Oberfläche des endoplasmatischen Retikulums.

Vermutlich würde sich das endoplasmatische Retikulum für uns rauh anfühlen, wenn wir nicht viel größer als eine Zelle wären. Tatsächlich ist das endoplasmatische Retikulum viel zu klein, um vom menschlichen Tastsinn wahrgenommen zu werden.

zurück

Die Bezeichnung "rau" bezieht sich auf das Aussehen der Oberfläche des endoplasmatischen Retikulums.

Selbst wenn man von rauen Sitten im Inneren einer Zelle sprechen könnte, hätte das nichts mit dieser Namensgebung zu tun.

zurück

Ribosomen auf seiner Oberfläche lassen das endoplasmatische Retikulum rau erscheinen.

Erkennen kann man das allerdings nur auf elektronenmikroskopischen Bildern. Aber wo wir gerade bei den Ribosomen sind, können wir auch gleich überlegen, was Ribosomen sind.

Was tun Ribosomen?
Ribosomen bringen Verdauungsenyzme vom Golgi-Apparat in die Endosomen.
Ribosomen entgiften die Zelle.
Wie kleine Roboter produzieren Ribosomen Proteine.

Verdauungsenzyme werden durch Lysosomen vom Golgi-Apparat in die Endosomen gebracht.

Ribosomen sind sehr viel kleiner als Lysosomen.

zurück

Peroxisomen entgiften die Zelle.

Peroxisomen sehen aus wie Vesikel, während ein Ribosom keine Membran besitzt.

zurück

Ribosomen synthetisieren Proteine.

Ribosomen bestehen zu etwa zwei Dritteln aus RNA, der sogenannten ribosomalen RNA oder rRNA. Rund ein Drittel ihrer Masse besteht aus über 50 Proteinen bei Prokaryoten oder über 80 Proteinen bei Eukaryoten. Ribosomen setzen sich erst kurz vor Beginn der Protein-Biosynthese (Eiweiß-Herstellung) im Cytoplasma aus zwei Untereinheiten zusammen, die beide im Zellkern gebildet wurden. Die kleinere enthält nur eine rRNA, die größere bei Prokaryoten 2 und bei Eukaryoten 3.

Um Proteine herstellen zu können, benötigen die Ribosomen ähnlich wie Roboter genaue Anweisungen. Denn ohne Rezept wissen sie nicht, in welcher Reihenfolge sie die Monomere (20 verschiedene Aminosäuren) zu einem Polymer (Eiweiß) verbinden sollen. Den Prozess der Übersetzung der Bauanleitung (Gen, mRNA) in die Reihenfolge (Sequenz) der Aminosäuren in einem Eiweiß nennt man Translation.

Translation an einem Ribosom
Aufbau der Nucleotide
Matthias M., Public domain
Wer oder was legt die Reihenfolge der vom Ribosom verknüpften Aminosäuren fest?
Die Reihenfolge der Aminosäuren in einem Protein wird bestimmt durch die Reihenfolge der Nukleotide im codierenden Teil eines Genes und durch die davon hergestellten mRNA-Kopien.
Die Aminosäuren werden in der Reihenfolge eingebaut, in der sie das Ribosom erreichen.
Jedes Ribosom stellt nur eine Sorte von Eiweißen her und der Plan dafür steckt in seiner ribosomalen RNA.

Die Reihenfolge (Sequenz) seiner Aminosäuren entscheidet über Form (Tertiärstruktur) und Funktion eines Proteins.

Weil die Tertiärstruktur die Funktion eines Proteins bestimmt, kann seine Primärstruktur (Aminosäuresequenz) nicht dem Zufall überlassen werden. Für jedes Protein gibt es eine Gen genannte Bauanleitung, welche der evolutionären Selektion unterliegt.

zurück

Alle Ribosomen im Zytoplasma einer Zelle enthalten die gleichen 3 bei Prokaryoten oder 4 verschiedenen rRNAs bei Eukaryoten. Nur die Ribosomen der Mitochondrien und Plastiden unterschieden sich von denen im Cytoplasma.

Daher können die Bauanleitungen für die Proteine nicht in den Ribosomen stecken.

zurück

Die Reihenfolge (Sequenz) der Aminosäuren in einem Protein wird bestimmt durch die Reihenfolge der DNA-Nukleotide (Nukleotidsequenz) im codierenden Teil (Exons) eines Gens.

Die Bauanleitung für ein Protein ist also ein Gen. Genauer gesagt steckt sie in einem Gen. Vor der Bauanleitung gibt es in den meisten Genen außerdem eine Art Schalter, der erst aktiviert werden muss, damit Kopien von dem Gen gemacht werden. Der codierenden Sequenz folgt noch ein Stopp-Signal (Terminator), welches den Abschreibevorgang beendet.

Wie nennt man das Ab- oder Umschreiben eines Gens und wie heißt das Produkt, das dann den Zellkern verlässt?
Das Umschreiben heißt Translation und das Produkt ist eine mRNA.
Das Produkt verlässt als mRNA den Zellkern und das Umschreiben von DNA in RNA nennt man Transkription.
Das Umschreiben heißt Transkription und das Produkt heißt rRNA, die in einer Ribosomen-Untereinheit den Zellkern verlässt.

Translation ist das amerikanische Wort für Übersetzung.

Das Kopieren der Nukleotidsequenz einer DNA (Gen) in die Nukleotidsequenz einer RNA (letztlich mRNA) ist aber keine Übersetzung, sondern da werden lediglich DNA-Nukleotide in RNA-Nukleotide umgeschrieben. Das Material ist ein anderes, aber die Information bleibt die selbe.

zurück

Es gibt auch Gene für rRNAs, die zusammen mit vielen Proteinen im Zellkern zu Ribosomen-Untereinheiten zusammen gebaut werden.

Die gewählte Aussage an sich ist also korrekt und sie beantwortet auch die Frage. Trotzdem soll es hier um die Transkription eines Gens in eine mRNA gehen, weil wir den Weg der Information vom Gen zum Protein verfolgen.

weiter

In der Tat werden Gene transkribiert.

Ein Gen ist eine Informationseinheit oder genauer gesagt eine Bauanleitung. Das kann die Bauanleitung für eine rRNA, tRNA oder snRNA sein oder die Bauanleitung für ein Protein. Die Information steckt in der Reihenfolge der DNA-Nukleotide der DNA, die zusammen mit verschiedenen Proteinen ein Chromosom bildet. Bei der Transkription wird die Nukleotidsequenz der DNA in die Nukleotidsequenz einer RNA umgeschrieben, also transkribiert. Der Unterschied zwischen DNA-Nukleotiden und RNA-Nukleotiden besteht nur darin, dass den DNA-Nukleotiden ein einziges Sauerstoff-Atom fehlt. Außerdem enthält RNA statt der Nukleobase Thymin die sehr ähnliche Base Uracil, der verglichen mit Thymin nur eine Methylgruppe fehlt.

Schema der Transkription
Transkription
Roland Heynkes, CC BY-SA 3.0. Ich habe nur die Größe der RNA-Polymerase korrigiert und ein Schema ins Deutsche übersetzt, das von einem anonymen Zeichner als public domain der Wikimedia zu Verfügung gestellt wurde.

Die Transkription wird durch ein Enzym katalysiert, das DNA-abhängige RNA-Polymerase oder kurz RNA-Polymerase heißt, weil es nach der Vorlage einer DNA-Nukleotidsequenz aus vielen einzelnen RNA-Nukleotiden (Monomeren) ein langes Polymer herstellt. Dieses Polymer heißt RNA. Das Schema zeigt, wie an der RNA-Polymerase die beiden DNA-Einzelstränge der DNA-Doppelhelix getrennt werden, damit an einem der beiden DNA-Einzelstränge einzelne RNA-Nukleotide neue Basenpaare bilden und dann durch das Enzym zu einem primären (ersten, ursprünglichen, noch unveränderten) RNA-Transkript verbunden werden.

Bei Prokaryoten entsteht dabei normalerweise direkt eine mRNA. Bei Eukaryoten nennt man das (primäre) Produkt der Transkription prä-RNA (Vorläufer-RNA) oder hn-RNA. Vor allem zur Stabilisierung werden an die prä-RNA vorne (am 5'-Ende) eine Kappe (Cap-Struktur) und hinten (am 3'-Ende) viele Adenin-Ribonukleotide (poly-A-Schwanz) angehängt. Diese Bearbeitung der hn-RNA nennt man Prozessierung und dazu gehört auch noch das sogenannte Splicing. So nennt man international das Herausschneiden von Abschnitten der hn-RNA, die nicht als Bauanleitung für das Protein genutzt werden sollen. Das Ergebnis der Prozessierung (Bearbeitung) ist schließlich die mRNA, die dann durch eine Kernpore den Zellkern verlässt.

Was geschieht im Cytoplasma mit der mRNA?
Die mRNA wird in eine Ribosomen-Untereinheit eingebaut.
Im Cytoplasma wird die mRNA abgebaut.
Im Cytoplasma wird die mRNA von den Untereinheiten eines Ribosoms gepackt und als Bauanleitung für ein Protein benutzt.
Die mRNA wird in Vesikel verpackt und von Motorproteinen zur Poststation Golgi-Apparat transportiert.

Ribosomen-Untereinheiten entstehen nicht im Cytoplasma, sondern im Zellkern.

Und es wird keine mRNA eingebaut, sondern rRNA.

zurück

Natürlich wird die mRNA im Cytoplasma abgebaut.

Sonst würde ja die Zelle immer weiter Proteine produzieren, die längst nicht mehr gebraucht werden. Aber bevor eine mRNA abgebaut wird, hat sie in der Zelle eine wichtige Aufgabe zu erfüllen.

zurück

Die mRNA verlässt das Cytoplasma nicht.

Daher wird sie weder in Vesikeln transportiert, noch gelangt sie in den Golgi-Apparat.

zurück

Die mRNA dient im Cytoplasma den Ribosomen als Bauanleitung für Proteine.

Die Informationen der Bauanleitung stecken in der Reihenfolge der Nukleobasen in der mRNA. Das Problem dabei ist, dass es nur 4 verschiedene Basen (A,C,G,T) gibt, mit denen 20 verschiedene Aminosäuren codiert werden müssen. Möglich ist das nur, indem jeweils 3 Nukleotide zu einer Art Wort, einem sogenannten Codon zusammengefasst werden. Weil diese Codons (Wörter) aber ohne Lücken direkt hintereinander stehen, muss man genau wissen, an welcher Position man zu lesen beginnen muss. Bei einer Verschiebung des Leserasters um ein oder zwei Nukleotide misslingt die Übersetzung, weil dann völlig andere Wörter entstehen. Deshalb beginnt das Ribosom immer am Startcodon AUG mit der Übersetzung (Translation) der Reihenfolge der Codons der mRNA in die Sequenz der Aminosäuren im Protein.

Die Codonsonne ordnet jedem Codon eine Aminosäure zu.
die Codon-Sonne
Mouagip, Public Domain

Die Aminosäuren stehen ganz außen und die Codons werden von innen nach außen, von den größten zu den kleinsten Buchstaben gelesen. Beginnt man beispielsweise im innersten Kreis mit dem A, wählt im zweiten Kreis ein U und endet im dritten Kreis mit einem G, dann stehen im vierten und äußersten Kreis Met und M für die Aminosäure Methionin. Das Codon für Methionin ist also AUG, welches gleichzeitig auch das Startcodon ist. Mit Hilfe der Codonsonne können wir ermitteln, in welches Peptid die folgende mRNA-Sequenz übersetzt würde:

AAGCUAUGCGCUUCGCUAGCUAGC
Lys-Leu-Cys-Ala-Ser-Leu-Ala
Ser-Tyr-Ala-Leu-Arg
Met-Arg-Phe-Ala-Ser

Die Translation beginnt immer erst mit dem Startcodon AUG.

Versuche es noch einmal!

zurück

Die Translation beginnt immer erst mit dem Startcodon AUG.

Versuche es noch einmal!

zurück

Die Translation beginnt mit dem Startcodon AUG und endet mit einem Stoppcodon.

Dazwischen werden immer jeweils 3 Nukleotide (Tripletts bzs. Codons) in eine der 20 Aminosäuren übersetzt, aus denen normale Proteine bestehen. Die Übersetzung erfolgt mit Hilfe sogenannter tRNAs. Das sind spezielle RNAs, die ähnlich wie Proteine eine bestimmte räumliche Struktur annehmen. Aus dieser Struktur ragen unten 3 Basen heraus, die Basenpaare mit einem passenden Codon der mRNA bilden können. Dieses Triplett von 3 Basen am Fuß der tRNA wird deshalb Anticodon genannt. Weil Basenpaarungen nur zwischen den Basen A und T sowie zwischen den Basen C und G gebildet werden können, sorgt das Anticodon am einen Ende der tRNA automatisch dafür, dass jede tRNA nur an ganz bestimmte Codons der mRNA bindet. An ihrem anderen Ende hängt an jeder tRNA eine Aminosäure. Und zwar nicht irgendeine Aminosäure, sondern immer nur die einzige zum jeweiligen Anticodon passende.

So bindet beispielsweise an das Startcodon AUG der mRNA nur eine tRNA mit dem dazu passenden Anticodon UAC. Und an der Start-tRNA mit dem Anticodon UAC hängt immer nur die Aminosäure Methionin.

Am Ribosom binden immer wieder an zwei benachbarten Codons der mRNA die passenden Anticodons zweier passender tRNAs. Dadurch kommen sich die Aminosäuren an den anderen Enden beider tRNAs nahe und werden vom Ribosom miteinander verbunden. Genauer gesagt überträgt das Ribosom die Aminosäure der tRNA am Vorläufer-Codon auf die Aminosäure der tRNA am Nachfolger-Codon. So entsteht eine wachsende Kette von Aminosäuren, also zunächst ein Peptid und schließlich ein Protein. Man sieht das alles in der Zeichnung von Matthias M..

Translation an einem Ribosom
Aufbau der Nucleotide
Matthias M., Public domain
Welche Aminosäure hängt an einer tRNA mit dem Anticodon CCC?
Prolin
Glycin
Die Codonsonne ordnet jedem Codon eine Aminosäure zu.
die Codon-Sonne
Mouagip, Public Domain

Die Codonsonne übersetzt Codons in Aminosäuren und nicht Anticodons.

Man muss also zuerst zum Anticodon CCC das dazu passende Codon GGG finden und dann in der Codonsonne die dazu gehörende Aminosäure Glycin.

weiter

Die tRNA mit dem Anticodon CCC bringt die Aminosäure Glycin zum Ribosom.

Damit sollte auch die Translation im Prinzip verstanden sein. Wird das Protein im Cytoplasma gebraucht, dann findet die Translation einfach im Cytoplasma statt. Soll jedoch das Protein im Endoplasmatischen Retikulum (ER) noch weiterverarbeitet und eventuell in Vesikel verpackt werden, dann wandert das Ribosom mit der mRNA zum ER, dockt daran an und produziert das Protein direkt in das Innere des ER oder in dessen Membran hinein. Im Inneren des ER können viele verschiedene Arten von chemischen Modifikationen an den Proteinen vorgenommen werden. Anschließend bleiben manche Proteine im ER, aber die meisten werden in Vesikel verpackt und abtransportiert.

Was aber ist ein Vesikel?
Vesikel nennt man kugelförmige Anordnungen oberflächenaktiver Moleküle in einer Flüssigkeit.
Vesikel sind winzige Bläschen im Inneren von Zellen mit einer Hülle aus einer Membran.

Chemiker bezeichnen tatsächlich bestimmte kugelförmige Anordnungen oberflächenaktiver Moleküle in einer Flüssigkeit als Vesikel.

In der Biologie wird der Begriff aber anders verstanden.

zurück

Tatsächlich ist in der Biologie mit einem Vesikel ein winziges Bläschen im Inneren von Zellen mit einer Hülle aus einer Membran gemeint.

Im Inneren von Vesikeln werden Proteine und andere Moleküle innerhalb von Zellen transportiert. Mit ihren Hüllen bringen Vesikel aber auch Membranen vom Endoplasmatischen Retikulum zum Golgi-Apparat, zu den Lysosomen, Endosomen und zur Zellmembran sowie von der Zellmembran durch Endosomen zu den Lysosomen, wo sie wieder zerlegt werden. Man nennt dies den Membranfluss und die folgende Animation zeigt diesen ständigen Fluss von Membranen.

Membranfluss
animiertes gif zum Membranfluss
Roland Heynkes, CC BY-SA 3.0
Was ist und wozu dient der Golgi-Apparat?
Der Golgi-Apparat ist ein Stapel von Membranbläschen. In ihm werden Eiweiße gelagert.
Der Golgi-Apparat besteht aus mehreren Dictyosomen genannten Stapeln von Membranbläschen und dient der Zelle als eine Art Poststation.

Der Golgi-Apparat ist eine Art Poststation der Zelle.

Der Golgi-Apparat ist nicht ein Stapel von Membranbläschen, sondern er besteht aus mehreren Stapeln, von denen jeder einzelne Dictyosom genannt wird. In diesen Dictyosomen werden die Eiweiße auch nicht gelagert.

weiter

Der Golgi-Apparat ist eine Art Poststation der Zelle.

Er besteht aus mehreren Stapeln von Membranbläschen, von denen jeder einzelne Dictyosom genannt wird.

In diesen Dictyosomen werden Eiweiße erneut modifiziert, dann sortiert und schließlich für den erneuten Transport in neue Vesikel verpackt.

Wir sind am vorläufigen Ende des Lernprogramms. Hoffentlich hat es jemandem geholfen.

buchunabhängige Lerntexte

meine Biologieseite

Kommentare und Kritik von Fachleuten, Lernenden und deren Eltern sind jederzeit willkommen.

Roland Heynkes, CC BY-SA-4.0